BGI 5128 PDF

  • June 14, 2019

*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.

Author: Goramar Taran
Country: Romania
Language: English (Spanish)
Genre: Music
Published (Last): 25 May 2015
Pages: 349
PDF File Size: 16.27 Mb
ePub File Size: 20.60 Mb
ISBN: 886-7-90991-512-4
Downloads: 45468
Price: Free* [*Free Regsitration Required]
Uploader: Yokinos

Published by Oxford University Press. Previously classified as 2-nitropropane dioxygenase EC 1.

Close mobile search navigation Article navigation. In progress issue alert. Crystal structure of 2-nitropropane dioxygenase complexed with FMN and substrate.

It furthers the University’s objective of excellence in research, scholarship, and education by publishing worldwide. J Biol Chem NAD P H reductase subfamily. J Biol Chem C ]; nitrite [CPD: The enzyme uses FADH2 as a substrate rather than a cofactor [4].

Sponsors of Barbados Gospelfest 2018 “Touching Lives Changing Nations”

The lined seahorse, Hippocampus erectusis an Atlantic species and mainly inhabits shallow sea beds or coral reefs. Draft genome of the lined seahorse, Hippocampus erectus Qiang Lin.

  EFFET MULTIPLICATEUR KEYNES PDF

ExplorEnz – The Enzyme Database: Re analyzing community-wide datasets without major infrastructure. Characterization of an Escherichia coli aromatic hydroxylase with a broad substrate range.

Identification of the catalytic base. Biochim Biophys Acta GigaScience512 6, Issue 6, 1 Junegix, https: The enzyme from Escherichia coli attacks a broad spectrum of phenolic compounds. In order to improve big aquaculture yield of this valuable fish species, we are trying to develop genomic resources for assistant selection in genetic breeding.

Characterization of 4-hydroxyphenylacetate 3-hydroxylase HpaB of Escherichia coli as a reduced flavin adenine dinucleotide-utilizing monooxygenase. Citing articles via Web of Science 2. The contig N50 and scaffold N50 reached Molecular characterization of 4-hydroxyphenylacetate 3-hydroxylase of Escherichia coli.

Email alerts New issue alert.

Preços referenciais B3 – prêmios de opções

The enzymes from the fungus Neurospora crassa and the yeast Williopsis saturnus var. Gadda G, Francis K.

Xun L, Sandvik ER. The enzyme from N. Availability of supporting data. Receive exclusive offers and updates from Oxford Academic.

  ASTM D4268 PDF

Run Accession List – DRA Search

These generated genomic data are going to enrich genome resource of this economically important fish, and also provide insights into the genetic mechanisms of its ngi morphology and male pregnancy behavior.

C ]; O2 [CPD: A two-protein component enzyme. R R R R R Using 518, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated assembly, which is less than our previously reported gene number 23 of the tiger tail seahorse H.